Winter Season 2010

Publicado: diciembre 28, 2010 en Uncategorized

Y estamos de vuelta, esta vez para tomar un poco más en serio este blog y hablar de lo que realmente me gusta, el ANIME. Les informo que voy a integrar colaboraciones para no hacer esto tan aburrido y unilateral. Lamento no haber terminado mi terrible historia shoujo, pero será en otro momento.
Repasando a través de los blogs: Thatanimeblog y Random curiosity he estado formando mi selección para esta linda temporada que se aproxima. Linda, porque Kimi ni todoke 2 por fin está aquí! Levanten la mano aquellos que querían verla?!! Me imagino que hay muchos cabezones con las manos levantadas ahora mismo, yo soy una!. Fuera de dicha serie mi selección para ver será la siguiente (vean el post de random curiosity http://randomc.net/2010/12/25/winter-2011-preview/):
1. Starry Sky: La voy a ver, aunque no me gustan los Harem, porque trata de los signos del zodiaco y yo soy fan de la astrología, quiero ver como cada quien personifica el signo correspondiente!
2. Yumekui Merry, le voy a dar un vistazo a par de episodios, básicamente porque trata del tema de los sueños y las pesadillas pero no estoy muy optimista con esta serie. Puede ser que se gane un drop.
3. GOSICK, oh dear! kawaii!!!!! Seguro que la veré, se ve ultra Moe la protagonista y no puedo evitar gritar KYAAAAAA.
4. Beelzebub, otra que seguro me va a hacer llorar de la risa. Las historias de delincuentes de por sí son entretenidas, mezcladas con demonios? veamos que pasa.
5. Level E, le voy a hacer un sondeo, muchos están escepticos con la serie por lo tanto aventuraré con mirar dos episodios por lo menos.
6. FRACTALE, must see, la reputación del autor de este anime está en juego con esta producción, será lo que promete ser?
7. xxxHOLIC Rou Adayume (OVA) que saldrá en Marzo, de gran interés para los seguidores de esta serie.

Recién saqué una cuenta de twitter @animenewbie, así postearé libremente breves comentarios.

Feliz Navidad y bienvenido sea el Winter Season!

Anuncios

El “mañana” mío como que se extendió un poco. ¡Dejé la historia del pobre pana a mitad de un momento muy crítico!

Sigamos sin perder tiempo!

En menos de 1 minuto de haber abierto la boca los bu’ca pleito’ del grupo ya lo tenían rodeado. Como es de esperarse, empezaron a halarle la camisa, a darle “toma que lleva” en el caquito, y el tipo tratando de sacudirse los buloyas que ni lo habían dejado hablar. La “bosu” se paró del murito donde estaba sentada a tripiar en el medio también, porque na’ más es chiquita pero rebusera. Obviamente el acoso contra el pobre muchacho que acababa de aparecer es na’ más por tener pinta de lindo, nadie lo manda a meterse en esa selva. Entonces ella se pone en medio del asunto y le aplica rápidamente una tuerca que ni Bruce Lee al pobre muchacho y ya lo tiene en el suelo aplastado, ella con manos en los bolsillos y con un pie sobre la cara del rubio! Aaaaay aaaayyyy. De manera burlona le pregunta “hermano, pero y qué usted busca por aquí?” Y entre dientes el dice “Anata to hanashi ga shitai desu” (“quiero hablar contigo”).. la jeva se rie estruendosamente como siempre “oye pero que coyons tu tienes muchachito que viniste hasta aquí a hablar conmigo, ¿qué es lo que tú quieres?” , y en dos segundos se pone el pana (aún con la cara pegada al suelo) rojo como un tomatico Barceló y le dice “es un asunto privado”. No puedo ni explicarles la bulla que se armó allí, los tigueres estrallados de la risa y las mujeres también, para hacerlo pasar más vergüenza todavía la jeva le dice “no pero dígalo aquí man, yo no tengo secretos con mi gente”, y es en este momento que yo digo que a este jevito hay que sacarle su plato aparte porque es una de dos: o un loco desquiciao’ o superman, porque en medio de ese lío el tipo se atreve a decir, no a decir no, a vocear apretando los ojitos, “YO QUIERO SALIR CONTIGO” mientras una nubecita de humo sale de su cabeza caliente de verguenza.

No, en serio que este pana tiene que estar loco. Un silencio fúnebre se hizo por un momento y PLA! La risa del grupaso entero, CUACUACUACUACUACUACUA!, pero, sorpresivamente cuando todo el grupo mira a la “bosu” ella miraba la cara del tipo debajo de su pie muy seriamente en silencio y un brillo de alguna idea macabra pasó por sus ojos, Plin! (este es el sonido del brillo jaja). Y así mismo de una manera calmada despegando el pie de la cara del tipo ella le dice: “ii … “       (que significa OK! ) y en esta última escena se ven las caras de los miembros de todo el grupo con los ojos como pesetas o pecao de boca chica gritando juntos “NANIIIIIIIIIIIIIIIIIIIIIIIIIIII” (EL QUEEEEEEEEEEEEEEEEEEEEEEEEEEE????).

Segundo capítulo de mi historia shoujo

Publicado: enero 28, 2010 en post
Etiquetas:

Pue si. El pobre rubio se ha pasado el día en el colegio sudando la gota gorda pensando en cómo acercarse a la bacana. Por supuesto que la gente no se da cuenta porque lo único que ven en él es un tiguere que está como quiere y que no coge corte. Que ingenua la gente, que no sabe su realidad. Eso pasa por estar privando lo que no es.
Desde su silla nada más puede escuchar la risa super chillona de su amor quien ahora tiene varias panas de la misma liga peligrosa que se sientan con ella. Con oir esa risita se le erizan los pelos, pero de los nervios.
Resulta que para rematar la ha escuchado voceandole a sus amigas que ella no hay cosa que deteste más que los “jevitos lindos”, AY, le retumban los oídos y se le detiene el corazón a nuestro protagonista. Si, porque definitivamente el cae dentro de la categoría de jevitos lindos. Seguro que el comentario de la pana no fue precisamente dirigido a él, porque ella ni se ha dado cuenta de su existencia, pero como quiera no es para menos, así cualquiera se vuelve un cero.
Llega la hora del recreo y tiene que irse a su mega refugio rápidamente, el baño. Sentado en el retrete comienza a pensar que definitivamente esta situación no es igual a las veces que simplemente se ha hecho el loco con la barsa de cartas de amor que le han llegado de las chicas de la escuela, privando en bueno (pero realmente siendo un cobarde), ahora va a tener que tirarse a la boca de un león, y grande!, si quiere que su fiera salvaje le haga el coro.
Sale de ahí y comienza a caminar con las piernas medio tembleque, bueno, se muerde la boca y respira un bocanado de aire y ahora empieza a caminar tieso como un robot, los nervios, los nervios! Y va de camino para donde la jevaaaaaaa! (ya a mi hasta pena me da el pana, el no se quiere parece).
Allá lejos en el patio del colegio, en la parte detrás de la escuela, para donde nadie le gusta meterse, está la muchacha con su grupo de maleantes, el grupo más pintoresco con gente de todos los cursos de la escuela, pero no puedo decir que los más populares.
La conversación que están teniendo en ese grupo, la cual el lamentablemente no alcanza a oir, es que la
jeva está discutiendo porque su novio (o más bien ex), la acaba de dejar por una que ella misma fue
quien metió a su grupo y la “crió” por así decir. No estaría de más mencionar que el ex es el líder de
un grupo de rock pesado y principal figura de terror en otra escuela de la misma área. Lo cual, sin
tener que ser un genio, nos lleva a la conclusión de que nuestra temida protagonista es la “Bosu” (la
jefa) matatana de esta escuela cuando se trata de esta recua de malandros. La “bosu” sólo está pensando la manera cruel de vengarse de su , ahora detestado, ex.
Por supuesto que nadie se está percatando de la aparición del rubio y el ha intentado de sacar la voz
para pedir permiso pero está blanco del terror, tanto que ni oye ni siente, ni na. Cuando consigue un
poquito más de aire se oye el “etoooooooooo sumimaseennnnn” (“esteeee….permisooooo”), y queda tieso cuando el grupo entero se voltea y lo miran con cara de….. “este no quiere su vida que está aquí”.

ay ,, sigo el cuento mañana porque ahora tengo sueño! …….. jiji… byeee

me: Ya se el tema para un anime shoujo!
😀
Tengo que escribirlo

Naife: ????????????????

me: Si si. Mira, sería que llega una chica maluca al colegio, transfer student. De esas que estan vestidas con tigueraje y medio punk. Entonces en ese colegio hay un chico que todas las chamaquitas estan aficia de él.

Naife: lol

me: Y el tipo siempre tiene la cara de que es kakkoi (cool), y dizque callado y serio, pero en realidad el tipo lo que es un tímido hasta la muerte y nadie lo sabe. Cuando pasa por los pasillos va con cara dizque de indiferente y misterioso, va oyendo por los pasillos a las chicas derritiéndose y hablando de él. Pero el sigue caminando siempre a entrar al baño y cuando entra y ya sube la cara la tiene como un tomate de la verguenza.
Entonces un dia llega a la escuela una estudiante transferida de otra escuela, una de esas chicas con pinta de pandillera.

Naife: jajjaa

me: La jeva llega y la presentan en el curso, Y ella se dirige a su asiento con la cara en alto mirando a todo el mundo como “what do u want”! (Qué demonios ustedes quieren?!)
Y todos los estudiantes miran para abajo o para otro lado intimidados, el unico que nadie se da cuenta que sigue mirando para arriba e idiotizado es el rubio buenazo que ha quedado prendado (aficiao) de la delincuente!
Pasan dias y eso y el tipo ta aficiao de su mujer que obviamente es una indecente, malapalabrosa y bucapleito. El nunca ha tenido novia, y esta desvastado y desalentado porque piensa que ella nunca le haria caso. Y ni hablar de confesar su amor porque primero es muy cobarde y segundo si ella no lo acepta lo mas probable es que ella le de una paliza!
Entonces en su casa comienzan a notar que esta un poco depre el muchacho. El vive en una casa grande esas tradicionales del japon con muchos integrantes de su familia. Tiene dos hermanitos mas pequeños gemelos, una hembra y un varón, y viven un par de abuelos, su mamá y su papá, un tío y su esposa, y el hijo mocoso de esa pareja. Pero bueno, es una casa grande.

El abuelo es el que se da cuenta de que el pobre muchacho no esta comiendo bien y no esta haciendo su habitual protesta de que los hermanitos y el primo lo estan molestando. El abuelo le pregunta que es lo que esta pasando.

mmmmmmmmm, dejame pensar.

Naife: bakaa jajaja
piensa piensa

me: entonces … el abuelo le dice que tiene la cara de tener el corazon roto

me: Bueno, el chamaco se sorprende cuando el abuelo le dice eso y le pregunta que como se dio cuenta!
(obviamente se le notaba en la cara a 60 mil leguas de distancia) y el abuelo se da un poco de bombo diciendo que son los años de la experiencia en el amor (viejo baboso).
Pue si… el chamaco le dice que esta enamorado de una chica que es muy distinta a el, y mas determinada y decidida, con una personalidad un poco mas fuerte (lo unico que no le aclara que es una delincuente mal hablada). Y que cree que no le serviria de nada confesarse porque la jevita seguro que lo va a rechazar, que no habra chance con el.
En ese instante el viejo se voltea silenciosamente y abre un closet y saca unas fotos viejas que estaban en una caja en el tope del closet (por cierto, este viejo es un viejito con una colita y con pinta de relax)

Naife: lol

me: y el viejo saca sus fotos y se ve el con su pelo largo, cuando estaba joven, suelto, gafas, y una pinta hippy que no mandaba madre

Naife: tienes q decirle a neko q le haga la animacion lol

me: jajajajaja

Naife: puedes hacer un oneshot!

me: ya lo sabe
no, yo quisiera dos, dos shots, porque la historia despues tiene otro twist.

Naife: ok sigue
jajajjaja

me: entonces

Naife: 1 oneshot y la secuela

me: en la foto esta el viejo con su pinta y al lado esta una muchacha joven, reservada , con lentes (meganeko), con un suit negro. Muy nerd ella, o muy business like (chica de negocios).
y el muchacho le pregunta que quien es la chica
y el abuelo le dice “esa es tu abuela”
y el muchacho queda pasmado, porque la abuela que el tiene viendo toda su vida para NADA tiene esa pinta.
La abuela actualmente es una señora relax como su abuelo, con el pelo largo suelto, con ropas relax también y que siempre ha estado en la casa y atendiendo el negocio de jardineria que ellos tienen en la misma casa. (o mejor floristeria?)
El abuelo le explica que si… que ella era esa persona y que pasó más trabajo quel DIACHE para poder salir con ella, porque eran muy distintos y al principio también tenía miedo que ella no lo fuera a aceptar, e incluso la familia de ella. Y cuando se decidió a pedirle amores la primera vez la abuela lo rechazó
pero estuvo atrás de ella y apareciendosele en todos lados y haciendole canciones hippies hasta que la vieja cedió, y le dió el sí cuando el le pidió la segunda vez.

La cuestion es que el chamaco con esta historia se siente un poco motivado, aunque no le gusta que cuando se hace la pregunta de que “que seria lo peor que podria pasar si me dice que no?” lo unico que se imagina es que lo encuentren abollado debajo de un puente despues de semana desparecido con moscas pasandole por todas partes.

La ultima escena se ve el muchacho entrando al otro dia al colegio en la puerta principal apretando los puños y diciendose a si mismo YOSH!!!! GANBARIMASU!!!! (OK! ME VOY A ESFORZAR!)

…………… veamos lo que pasa en la segunda parte.

Comentarios y updates

Publicado: abril 5, 2009 en Uncategorized

Estaba leyendo mi antepenúltimo post sobre lo que estaba viendo y ya ni me acordaba de esas cosas jajajaja. Lo que sí es que lo ví todo y todavía Soul Eater no ha terminado. Por otro lado de las dos últimas temporadas estuve viendo: Toradora, Michiko to hatchin, Kuroshitsuji, Munto (Tv Series), Skip Beat, Junjou romantica 2, Hyakko, Kannagi, Maria Holic, Xam’d Lost Memories,  Clannad After Story, entre otras.

Las que me han decepcionado con sus horribles y poco elaborados finales han sido Toradora y Munto. Maria+Holic nunca tuvo mucho sentido por lo que no esperaba mucho de su final y por eso no me decepcionó, Junjou parte 2 también digo lo mismo, no tuvo mucho contenido en general así que daba lo mismo como terminaba.  Pero caramba, me dolió con Toradora y Munto, las dos empezaron bien, captaron mi atención, tuvieron episodios bien buenos y luego….. desastrosos finales, apresurados o demasiado desasociados con la serie completa.

Xam’d: Lost memories fue una joya, para quienes les gusta la acción, robots, mutaciones extrañas, gente medio esotérica, esto es definitivamente una obra maestra. Es tan profunda que al final no entendí nada jajajaja, y sólo me quedaba pensando “yo sé que es algo super inteligente lo que están diciendo, no entiendo lo que es, pero estoy más que segura que es algo super inteligente! “.

Cosas que han llegado a mi mano que están fuera de temporada y son “viejitas”: Real Drive (que creo es más fácil encontrarla con el nombre de RD Sennou Chosashitsu), Hanada Shonen Shi, Tengen Toppa Gurren Lagan y Eureka Seven. Ucha, que puedo decir, Real Drive es lenta, lentísima, pero me enamoré de la serie, no espero que sea el gusto de todo el mundo, tiene cosas muy de shoujo y episodios raros pero hay que verla completa porque tiene una serie de peleas simples que capturan y unas imágenes que no sé cómo explicar, lleno de escenas futuristas y mucha tecnología. Hanada Shonen Shi es pura risa, es sobre un niño que por una razón puede ver fantasmas y le pasan mil cosas, uno llora, se rie, de todo. Esa es una animación vieja, las imágenes no son de lo último pero el contenido es genial.

Tengen Toppa Gurren Lagan y Eureka Seven son del género Mecha, Eureka Seven es del mismo estudio que Xam’d Lost Memories y el diseño de los caracteres y ciertos aspectos guardan similitud. Las dos te mantienen cautivo hasta el último segundo, no quieres pararte de la silla, y definitivamente los protagonistas son personajes tan inspiradores que te hacen querer luchar hasta la muerte por tus sueños y por lo que amas. Coinciden en que todos son unos tercos impetuosos y bocones que luchan aunque los pise un tren!.

Acaba de empezar otra temporada y estoy en proceso de elegir las series para este momento, no sé si sabrán pero ahora está en el aire un OVA de XXXHOLIC (Xxxholic shunmuki) y un OVA de Tsubasa (Tsubasa Chronicle: Shunraiki) , y lo chulo es que vas a ver los personajes de un anime dentro del otro anime y hay escenas que van a coincidir en los dos! Están basados en capítulos bien avanzados de cada manga y los dos OVA’s sólo van a tener 2 episodios de los cuáles ya ha salido el primero de cada uno.

Cuando termine de decidir qué voy a ver en esta temporada lo voy a publicar.

Y resulta que hace un año atrás, justo en estos días, escribí un post sobre cómo encontrar buen anime para ver. Mi finalidad el día de hoy es decirles qué cosas han cambiado.

Si bien sigo utilizando la misma metodología (ver post anterior) he reducido la cantidad de blogs que visito para esto a dos:

http://that.animeblogger.nethttp://randomc.animeblogger.net/ . Esto porque han cerrado otros que leía y porque la verdad no tengo tiempo para leer tanto y encuentro que en esta corta selección hay material de sobra por el momento.

Entrar a http://www.fansubwiki.com/Main_Page es el “debo hacer” número uno. Ves ese listado enorme de animes que van a salir por temporada y hasta las horas en que van a salir en japón y luego puedes ver el primer episodio de cada uno (si tienes todo ese tiempo) y te quedas dándole continuidad al que más te guste. La ventaja de acompañar a este listado enorme con la lectura de los dos blogs anteriores es que esos dos blogs siempre publican sus selecciones de la temporada y te dicen su opinión de por qué o no le van a dar seguimiento a X serie. Eso ayuda a que ya sepas de antemano por qué algo podría ser una basura y te concentres en cosas que pueda que valgan la pena.

Como había expresado anteriormente las recomendaciones de amigos es lo que más peso tiene, porque tus amigos te conocen, y si tú y tus conocidos crean una lista en www.myanimelist.net todavía mejor!!!!!! Un año más tarde creo que es una de las mejores herramientas que he encontrado para servirme de aliada en mi exploración por el mundo del anime.  Myanimelist también te da rankings de animes, de da recomendaciones, puedes encontrar personas que han visto miles de animes (literalmente, MILES) que te pueden recomendar cosas, le das seguimiento a los episodios que has visto, tienes un tracking de esto y de lo que han visto o están viendo tus amigos. Es una maravilla. Esta es mi lista de animes vistos: http://myanimelist.net/animelist/animenewbie&status=7&order=0, entren a mi perfil también y déjenme algún comentario!!!.

Espero que estos posts los ayuden en su camino por la búsqueda de animes que le roben el corazón!

¿En qué estamos ahora?

Publicado: mayo 9, 2008 en Uncategorized

Veamos. Hace poco les comentaba a la mayoría por el messenger de la página www.myanimelist.net. Sugoi desu yo ne.  Me gustó esa página porque uno se entera de todo lo que ha visto y está viendo el otro. Mi hermosa y esplendorsa lista es ésta: http://myanimelist.net/animelist/animenewbie. (le cambié el nombre a mi animelist!)

Como verán tengo en “watching” 11 series pero tengo que aclarar que muchas están en hold (ahora mismo estoy editando eso en mi lista), unas por lo que explicaba en el post anterior de las series largas y otras porque no han subido los episodios con subtítulos. Las demás las intercalo por semana.

Tengo que decir que considero que han llegado muchas cosas interesantes a mis manos (gracias George y Nicolás!!): Code Geass, Kurau Phantom memories, Black Cat, Princess Tutu y de por sí esta temporada trajo consigo a XXxholic Kei (la segunda temporada de xxxholic, YEY!!!!!) , Kyouran kazoku Nikki, Soul eater, junjou romantica e Itzura Na Kiss que Naife nos ha recomendado y yo se la recomendé a María, está muy chula honestamente para quienes nos gusta el anime shoujo. Hay muchas otras cosas más que han salido en esta misma temporada que no estoy viendo pero quiero ver: vampire knight, kurenai, code geass R2 (cuando termine la primera), entre otras.

María Isabel nos recomienda ver Hana Yori Dango. Aunque la animación parece como de los años 80 😛 jijij, ella dice que es una serie super buena, Naife puede ser que te guste esta serie. Por otro lado, Gabriel San nos recomienda D. Gray Man y Claymore, estas son más de acción, para los que quieran ver golpes y demás, yo estoy muy interesada en verlas honestamente.

Por mi parte sigo recomendando Soul Eater! O sea, la animación está demasiado mortal, DEMASIADO MORTAL, es una serie un poco sosa, lo admito, o sea tiene sus peleas y eso y sus chistes pero como que le falta, particularmente la seiyu (voice actor, or whatever) de Maka , personaje principal, no me gusta como habla, parece una principiante, no obstante en general puede verse y se disfruta mucho la imágen, el movimiento, o sea, es muy linda esa animación!. Princess Tutu, serie que me prestó Nicolás, es SUPER sweet, la chica es una bailarina y tiene sus momentos bastante cursis, si si si, pero los chistes están bien logrados, los momentos de maldad también y los personajes tienen sus complicaciones agradables, I like it, ya casi la termino.

Otra cosa que debo mencionar es que en muchos blogs de anime veo mencionado a Aria, una animación que tiene su tiempo ya y bastantes temporadas y versiones. Es uno de mis próximos “proyectos”. Veo que por muchos lados, personas que también ven shoujo, la tienen en el más alto pedestal. Hace tiempo, ví un primer episodio y no le vi tan allá pero voy a darle un segundo vistazo porque me impresiona cuanta gente le da un puntaje alto.

Nada, si tienen algo que opinar o recomendar o decir por qué les gusta cierta serie deje sus comments!