Archivos de la categoría ‘Uncategorized’

Winter Season 2010

Publicado: diciembre 28, 2010 en Uncategorized

Y estamos de vuelta, esta vez para tomar un poco más en serio este blog y hablar de lo que realmente me gusta, el ANIME. Les informo que voy a integrar colaboraciones para no hacer esto tan aburrido y unilateral. Lamento no haber terminado mi terrible historia shoujo, pero será en otro momento.
Repasando a través de los blogs: Thatanimeblog y Random curiosity he estado formando mi selección para esta linda temporada que se aproxima. Linda, porque Kimi ni todoke 2 por fin está aquí! Levanten la mano aquellos que querían verla?!! Me imagino que hay muchos cabezones con las manos levantadas ahora mismo, yo soy una!. Fuera de dicha serie mi selección para ver será la siguiente (vean el post de random curiosity http://randomc.net/2010/12/25/winter-2011-preview/):
1. Starry Sky: La voy a ver, aunque no me gustan los Harem, porque trata de los signos del zodiaco y yo soy fan de la astrología, quiero ver como cada quien personifica el signo correspondiente!
2. Yumekui Merry, le voy a dar un vistazo a par de episodios, básicamente porque trata del tema de los sueños y las pesadillas pero no estoy muy optimista con esta serie. Puede ser que se gane un drop.
3. GOSICK, oh dear! kawaii!!!!! Seguro que la veré, se ve ultra Moe la protagonista y no puedo evitar gritar KYAAAAAA.
4. Beelzebub, otra que seguro me va a hacer llorar de la risa. Las historias de delincuentes de por sí son entretenidas, mezcladas con demonios? veamos que pasa.
5. Level E, le voy a hacer un sondeo, muchos están escepticos con la serie por lo tanto aventuraré con mirar dos episodios por lo menos.
6. FRACTALE, must see, la reputación del autor de este anime está en juego con esta producción, será lo que promete ser?
7. xxxHOLIC Rou Adayume (OVA) que saldrá en Marzo, de gran interés para los seguidores de esta serie.

Recién saqué una cuenta de twitter @animenewbie, así postearé libremente breves comentarios.

Feliz Navidad y bienvenido sea el Winter Season!

Anuncios

El “mañana” mío como que se extendió un poco. ¡Dejé la historia del pobre pana a mitad de un momento muy crítico!

Sigamos sin perder tiempo!

En menos de 1 minuto de haber abierto la boca los bu’ca pleito’ del grupo ya lo tenían rodeado. Como es de esperarse, empezaron a halarle la camisa, a darle “toma que lleva” en el caquito, y el tipo tratando de sacudirse los buloyas que ni lo habían dejado hablar. La “bosu” se paró del murito donde estaba sentada a tripiar en el medio también, porque na’ más es chiquita pero rebusera. Obviamente el acoso contra el pobre muchacho que acababa de aparecer es na’ más por tener pinta de lindo, nadie lo manda a meterse en esa selva. Entonces ella se pone en medio del asunto y le aplica rápidamente una tuerca que ni Bruce Lee al pobre muchacho y ya lo tiene en el suelo aplastado, ella con manos en los bolsillos y con un pie sobre la cara del rubio! Aaaaay aaaayyyy. De manera burlona le pregunta “hermano, pero y qué usted busca por aquí?” Y entre dientes el dice “Anata to hanashi ga shitai desu” (“quiero hablar contigo”).. la jeva se rie estruendosamente como siempre “oye pero que coyons tu tienes muchachito que viniste hasta aquí a hablar conmigo, ¿qué es lo que tú quieres?” , y en dos segundos se pone el pana (aún con la cara pegada al suelo) rojo como un tomatico Barceló y le dice “es un asunto privado”. No puedo ni explicarles la bulla que se armó allí, los tigueres estrallados de la risa y las mujeres también, para hacerlo pasar más vergüenza todavía la jeva le dice “no pero dígalo aquí man, yo no tengo secretos con mi gente”, y es en este momento que yo digo que a este jevito hay que sacarle su plato aparte porque es una de dos: o un loco desquiciao’ o superman, porque en medio de ese lío el tipo se atreve a decir, no a decir no, a vocear apretando los ojitos, “YO QUIERO SALIR CONTIGO” mientras una nubecita de humo sale de su cabeza caliente de verguenza.

No, en serio que este pana tiene que estar loco. Un silencio fúnebre se hizo por un momento y PLA! La risa del grupaso entero, CUACUACUACUACUACUACUA!, pero, sorpresivamente cuando todo el grupo mira a la “bosu” ella miraba la cara del tipo debajo de su pie muy seriamente en silencio y un brillo de alguna idea macabra pasó por sus ojos, Plin! (este es el sonido del brillo jaja). Y así mismo de una manera calmada despegando el pie de la cara del tipo ella le dice: “ii … “       (que significa OK! ) y en esta última escena se ven las caras de los miembros de todo el grupo con los ojos como pesetas o pecao de boca chica gritando juntos “NANIIIIIIIIIIIIIIIIIIIIIIIIIIII” (EL QUEEEEEEEEEEEEEEEEEEEEEEEEEEE????).

Comentarios y updates

Publicado: abril 5, 2009 en Uncategorized

Estaba leyendo mi antepenúltimo post sobre lo que estaba viendo y ya ni me acordaba de esas cosas jajajaja. Lo que sí es que lo ví todo y todavía Soul Eater no ha terminado. Por otro lado de las dos últimas temporadas estuve viendo: Toradora, Michiko to hatchin, Kuroshitsuji, Munto (Tv Series), Skip Beat, Junjou romantica 2, Hyakko, Kannagi, Maria Holic, Xam’d Lost Memories,  Clannad After Story, entre otras.

Las que me han decepcionado con sus horribles y poco elaborados finales han sido Toradora y Munto. Maria+Holic nunca tuvo mucho sentido por lo que no esperaba mucho de su final y por eso no me decepcionó, Junjou parte 2 también digo lo mismo, no tuvo mucho contenido en general así que daba lo mismo como terminaba.  Pero caramba, me dolió con Toradora y Munto, las dos empezaron bien, captaron mi atención, tuvieron episodios bien buenos y luego….. desastrosos finales, apresurados o demasiado desasociados con la serie completa.

Xam’d: Lost memories fue una joya, para quienes les gusta la acción, robots, mutaciones extrañas, gente medio esotérica, esto es definitivamente una obra maestra. Es tan profunda que al final no entendí nada jajajaja, y sólo me quedaba pensando “yo sé que es algo super inteligente lo que están diciendo, no entiendo lo que es, pero estoy más que segura que es algo super inteligente! “.

Cosas que han llegado a mi mano que están fuera de temporada y son “viejitas”: Real Drive (que creo es más fácil encontrarla con el nombre de RD Sennou Chosashitsu), Hanada Shonen Shi, Tengen Toppa Gurren Lagan y Eureka Seven. Ucha, que puedo decir, Real Drive es lenta, lentísima, pero me enamoré de la serie, no espero que sea el gusto de todo el mundo, tiene cosas muy de shoujo y episodios raros pero hay que verla completa porque tiene una serie de peleas simples que capturan y unas imágenes que no sé cómo explicar, lleno de escenas futuristas y mucha tecnología. Hanada Shonen Shi es pura risa, es sobre un niño que por una razón puede ver fantasmas y le pasan mil cosas, uno llora, se rie, de todo. Esa es una animación vieja, las imágenes no son de lo último pero el contenido es genial.

Tengen Toppa Gurren Lagan y Eureka Seven son del género Mecha, Eureka Seven es del mismo estudio que Xam’d Lost Memories y el diseño de los caracteres y ciertos aspectos guardan similitud. Las dos te mantienen cautivo hasta el último segundo, no quieres pararte de la silla, y definitivamente los protagonistas son personajes tan inspiradores que te hacen querer luchar hasta la muerte por tus sueños y por lo que amas. Coinciden en que todos son unos tercos impetuosos y bocones que luchan aunque los pise un tren!.

Acaba de empezar otra temporada y estoy en proceso de elegir las series para este momento, no sé si sabrán pero ahora está en el aire un OVA de XXXHOLIC (Xxxholic shunmuki) y un OVA de Tsubasa (Tsubasa Chronicle: Shunraiki) , y lo chulo es que vas a ver los personajes de un anime dentro del otro anime y hay escenas que van a coincidir en los dos! Están basados en capítulos bien avanzados de cada manga y los dos OVA’s sólo van a tener 2 episodios de los cuáles ya ha salido el primero de cada uno.

Cuando termine de decidir qué voy a ver en esta temporada lo voy a publicar.

Y resulta que hace un año atrás, justo en estos días, escribí un post sobre cómo encontrar buen anime para ver. Mi finalidad el día de hoy es decirles qué cosas han cambiado.

Si bien sigo utilizando la misma metodología (ver post anterior) he reducido la cantidad de blogs que visito para esto a dos:

http://that.animeblogger.nethttp://randomc.animeblogger.net/ . Esto porque han cerrado otros que leía y porque la verdad no tengo tiempo para leer tanto y encuentro que en esta corta selección hay material de sobra por el momento.

Entrar a http://www.fansubwiki.com/Main_Page es el “debo hacer” número uno. Ves ese listado enorme de animes que van a salir por temporada y hasta las horas en que van a salir en japón y luego puedes ver el primer episodio de cada uno (si tienes todo ese tiempo) y te quedas dándole continuidad al que más te guste. La ventaja de acompañar a este listado enorme con la lectura de los dos blogs anteriores es que esos dos blogs siempre publican sus selecciones de la temporada y te dicen su opinión de por qué o no le van a dar seguimiento a X serie. Eso ayuda a que ya sepas de antemano por qué algo podría ser una basura y te concentres en cosas que pueda que valgan la pena.

Como había expresado anteriormente las recomendaciones de amigos es lo que más peso tiene, porque tus amigos te conocen, y si tú y tus conocidos crean una lista en www.myanimelist.net todavía mejor!!!!!! Un año más tarde creo que es una de las mejores herramientas que he encontrado para servirme de aliada en mi exploración por el mundo del anime.  Myanimelist también te da rankings de animes, de da recomendaciones, puedes encontrar personas que han visto miles de animes (literalmente, MILES) que te pueden recomendar cosas, le das seguimiento a los episodios que has visto, tienes un tracking de esto y de lo que han visto o están viendo tus amigos. Es una maravilla. Esta es mi lista de animes vistos: http://myanimelist.net/animelist/animenewbie&status=7&order=0, entren a mi perfil también y déjenme algún comentario!!!.

Espero que estos posts los ayuden en su camino por la búsqueda de animes que le roben el corazón!

¿En qué estamos ahora?

Publicado: mayo 9, 2008 en Uncategorized

Veamos. Hace poco les comentaba a la mayoría por el messenger de la página www.myanimelist.net. Sugoi desu yo ne.  Me gustó esa página porque uno se entera de todo lo que ha visto y está viendo el otro. Mi hermosa y esplendorsa lista es ésta: http://myanimelist.net/animelist/animenewbie. (le cambié el nombre a mi animelist!)

Como verán tengo en “watching” 11 series pero tengo que aclarar que muchas están en hold (ahora mismo estoy editando eso en mi lista), unas por lo que explicaba en el post anterior de las series largas y otras porque no han subido los episodios con subtítulos. Las demás las intercalo por semana.

Tengo que decir que considero que han llegado muchas cosas interesantes a mis manos (gracias George y Nicolás!!): Code Geass, Kurau Phantom memories, Black Cat, Princess Tutu y de por sí esta temporada trajo consigo a XXxholic Kei (la segunda temporada de xxxholic, YEY!!!!!) , Kyouran kazoku Nikki, Soul eater, junjou romantica e Itzura Na Kiss que Naife nos ha recomendado y yo se la recomendé a María, está muy chula honestamente para quienes nos gusta el anime shoujo. Hay muchas otras cosas más que han salido en esta misma temporada que no estoy viendo pero quiero ver: vampire knight, kurenai, code geass R2 (cuando termine la primera), entre otras.

María Isabel nos recomienda ver Hana Yori Dango. Aunque la animación parece como de los años 80 😛 jijij, ella dice que es una serie super buena, Naife puede ser que te guste esta serie. Por otro lado, Gabriel San nos recomienda D. Gray Man y Claymore, estas son más de acción, para los que quieran ver golpes y demás, yo estoy muy interesada en verlas honestamente.

Por mi parte sigo recomendando Soul Eater! O sea, la animación está demasiado mortal, DEMASIADO MORTAL, es una serie un poco sosa, lo admito, o sea tiene sus peleas y eso y sus chistes pero como que le falta, particularmente la seiyu (voice actor, or whatever) de Maka , personaje principal, no me gusta como habla, parece una principiante, no obstante en general puede verse y se disfruta mucho la imágen, el movimiento, o sea, es muy linda esa animación!. Princess Tutu, serie que me prestó Nicolás, es SUPER sweet, la chica es una bailarina y tiene sus momentos bastante cursis, si si si, pero los chistes están bien logrados, los momentos de maldad también y los personajes tienen sus complicaciones agradables, I like it, ya casi la termino.

Otra cosa que debo mencionar es que en muchos blogs de anime veo mencionado a Aria, una animación que tiene su tiempo ya y bastantes temporadas y versiones. Es uno de mis próximos “proyectos”. Veo que por muchos lados, personas que también ven shoujo, la tienen en el más alto pedestal. Hace tiempo, ví un primer episodio y no le vi tan allá pero voy a darle un segundo vistazo porque me impresiona cuanta gente le da un puntaje alto.

Nada, si tienen algo que opinar o recomendar o decir por qué les gusta cierta serie deje sus comments!

 

Me aburro rápido, si, eso es así. O quizás puedan debatirlo diciendo que no es que me aburro rápido sino que tengo un short attention spam (es decir, atiendo un ratito y después ya ni sé de qué me están hablando). Mi punto con esto es que a pesar de que hago el intento sobrehumano no puedo a largo plazo sostener una serie, ya después de los 52 episodios (y forzando hasta los 70) realmente considero que es más que suficiente. 

Las series que prefiero generalmente son de 14 a 26 episodios, eso para mí es excelente. Pero bueno, aclaro que si algo es bastante entretenido puedo continuar. Por otro lado si la serie en toda su extensión está a mi alcance y no tengo que estar esperando episodios semanalmente pues claro que es un incentivo.

Los pobres de Bleach y Naruto los tengo completamente abandonados, y eso que estoy en episodios avanzados, pero es que…. me da pereza! Y es como sigue, sigue y sigue…. aaayy suspiroooo. De verdad que tengo que hacer el esfuerzo porque sé que me estoy perdiendo cosas que a lo mejor me interesarían, pero en serio que ME DA PEREZA!.  

María, no tengo tu entusiasmo y disposición para las series largas, no la tengo. Naife también! Que vió los episodios de Bleach en un dos por tres. Me pregunto si a los demás les gustarán series largas o cortas….jummm…

Antes que nada, tengo que reconocer que debo aclarar cómo consigo las series que decido ver. Creo que esto es algo vitalmente importante para no andar perdiendo tiempo viendo cosas que tengamos que dejar a mitad de camino (aunque eso realmente nunca deja de ocurrir).  Hay varias vías:

1. Recomendaciones de amigos o conocidos. Lo preferible aquí es que ya esa persona tenga una idea de tu gusto porque el ranking de un anime varía por persona considerando el género de su preferencia (shounen, shouho, mecca, slice of life, ecchi, etc).  

2.  Recurrir a Blogs de fanáticos del anime. Hay cuatro blogs que tengo en mis bookmarks que particularmente respeto:

http://that.animeblogger.net : Tiene muchos contribuidores con buenos reviews, cada contribuidor elige el anime que va a repasar al comienzo de cada temporada, a veces dos contribuidores eligen el mismo lo cual da una perspectiva más amplia.

 http://randomc.animeblogger.net/ : Es una sóla persona que ve MUCHOS animes y escribe sus comentarios o resumen para cada episodio, lo que más me gusta de este blog es que pone screenshots (imágenes) de cada episodio y eso a veces ayuda a uno o más bien lo anima a ver cierto anime.

http://anime.jefflawson.net/ : Este blog también lo escribe una sóla persona, es alguien que evalúa los animes de una forma profunda y concienzuda, esta persona es un poco más filosófica, me gusta mucho leerlo.

 http://wnfb.blogspot.com/  : La escritora es una jóven española muy simpática,  tiene reseñas para una cantidad grandísima de animes que si conoces el nombre puedes buscarlo en su blog para ver sus comentarios, asi te salvas de ponerte ver alguna tontería.

3. La página de Fansubwiki: http://www.fansubwiki.com/Main_Page  te dice por cada temporada los animes que se están televisando en japón y que grupo de fansubbers se está encargando de ponerle los subtítulos. Con esta página siempre estás al día de las series que están saliendo pero no es muy útil para tener un listado de animes clásicos.

4. Otras dos páginas como son http://www.animenewsnetwork.com/ y http://www.animesuki.com, en Anime News Network puedes ver las noticias sobre el mundo del anime pero también tiene una parte de “enciclopedia” y los Top 10 de distintos géneros incluyendo animes clásicos. En el caso de Anime Suki ahí entras en la parte del foro y siempre hay datos interesantes 😀 y aparte se pueden bajar por torrents los episodios de series no licenciadas.  

5. Revistas, libros o simplemente dar un search en google!.

Lo que si tienes que tener claro antes de incursionar en este tipo de búsqueda es el género que más te gusta, así puedes delimitar un poco.

Espero que esto resulte de ayuda especialmente a María! OIste Maríaaa!?